View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0750_low_74 (Length: 260)

Name: NF0750_low_74
Description: NF0750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0750_low_74
NF0750_low_74
[»] chr1 (2 HSPs)
chr1 (96-133)||(39239429-39239466)
chr1 (1-40)||(39239329-39239368)


Alignment Details
Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 96 - 133
Target Start/End: Original strand, 39239429 - 39239466
Alignment:
96 ttgcatgtataaggtgtcgatcagtttgtgtctctgct 133  Q
    ||||||||||||||||||||||||||||||||||||||    
39239429 ttgcatgtataaggtgtcgatcagtttgtgtctctgct 39239466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 39239329 - 39239368
Alignment:
1 ctcacttcatgggctagaaagttctattgatcatagtatc 40  Q
    |||||||||||||||| |||||||||||||||||||||||    
39239329 ctcacttcatgggctaaaaagttctattgatcatagtatc 39239368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University