View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0750_low_74 (Length: 260)
Name: NF0750_low_74
Description: NF0750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0750_low_74 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 96 - 133
Target Start/End: Original strand, 39239429 - 39239466
Alignment:
| Q |
96 |
ttgcatgtataaggtgtcgatcagtttgtgtctctgct |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39239429 |
ttgcatgtataaggtgtcgatcagtttgtgtctctgct |
39239466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 39239329 - 39239368
Alignment:
| Q |
1 |
ctcacttcatgggctagaaagttctattgatcatagtatc |
40 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39239329 |
ctcacttcatgggctaaaaagttctattgatcatagtatc |
39239368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University