View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0750_low_76 (Length: 258)
Name: NF0750_low_76
Description: NF0750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0750_low_76 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 24 - 221
Target Start/End: Original strand, 37436111 - 37436308
Alignment:
| Q |
24 |
tcttcattatttcctccttaactacaggtcagcaccatcttctctttccttcaactcttcatcttcaccattttgaccttcttacatctctaaaactagt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37436111 |
tcttcattatttcctccttaactacaggtcagcaccatcttctctttccttcaactcttcatcttcaccattttgaccttcttacatctctaaaactagt |
37436210 |
T |
|
| Q |
124 |
tgatactttaagtagattgatacatacgaatcaaacatagacacgaaaatcatacgtaaatattgataataacttaagaaaatgaaataattaaatat |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
37436211 |
tgatactttaagtagattgatacatacgaatcaaacatagacacgaaaatcatacgtaaatattgataataatttaagaaaatgaaataattaaatat |
37436308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3706 times since January 2019
Visitors: 4818