View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0750_low_78 (Length: 255)
Name: NF0750_low_78
Description: NF0750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0750_low_78 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 28064037 - 28063790
Alignment:
Q |
1 |
tttctggtggtattgttgtttctatctggaaaatcacaaataaatctagtttttcttaaacttcattaatttgaaaattcatcaggagcgacattcttat |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
28064037 |
tttctggtggtattgttgtttctatctggaaaatcacaaataaatatagtttttcttaaactttattaatttgaaaattcatcaggagcgacattcttat |
28063938 |
T |
 |
Q |
101 |
aaatcaatatacactcattaaaatgtcacggcgttatggtgtt-aaattttgtgaaaatgattgatggaaacaattgtagatgaaaaattaatgatttta |
199 |
Q |
|
|
|||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28063937 |
aaatcaatatacactcattaaaatgtcacggcattatggtgttaaaattttgtgaaaatgattgatggaaacaattgtagatgaaaaattaatgatttta |
28063838 |
T |
 |
Q |
200 |
gatgaaaattaccacatctatcaattcttcaattgcttcttctctgct |
247 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28063837 |
gatgaaaattaccacatctatcaattcttcaattgcttcttctctgct |
28063790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University