View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0750_low_79 (Length: 254)
Name: NF0750_low_79
Description: NF0750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0750_low_79 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 43800022 - 43799907
Alignment:
Q |
1 |
ctattacagctgtggttaattagatacactactataatagttgaagttcatgtttagattgaataggattaagctaaatcatgacttgctaaatcataac |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43800022 |
ctattacagctgtggttaattagatacactactataatagtttaagttcatgtttagattgaataggattaagctaaatcatgacttgctaaatcataac |
43799923 |
T |
 |
Q |
101 |
ttttgttacattatgg |
116 |
Q |
|
|
|||||||||||||||| |
|
|
T |
43799922 |
ttttgttacattatgg |
43799907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University