View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0750_low_84 (Length: 250)

Name: NF0750_low_84
Description: NF0750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0750_low_84
NF0750_low_84
[»] chr2 (1 HSPs)
chr2 (10-155)||(12899078-12899218)


Alignment Details
Target: chr2 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 10 - 155
Target Start/End: Original strand, 12899078 - 12899218
Alignment:
10 aacaatattatcgttgattataaagttatattatgtaattaaccttgcataactcataatttttcttatccatacaatattaattaaattcttatttttg 109  Q
    ||||||||||||||||||||||||||||||||||     ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
12899078 aacaatattatcgttgattataaagttatattat-----taaccttgcataactcataatttttcttatctatacaatattaattaaattcttatttttg 12899172  T
110 taaaatcgtcaaaaataacttgtaattttagacaaaataaatattg 155  Q
    |||||||||||||||  |||||||||||||||||||||||||||||    
12899173 taaaatcgtcaaaaacgacttgtaattttagacaaaataaatattg 12899218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 5619 times since January 2019
Visitors: 4857