View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0750_low_86 (Length: 248)

Name: NF0750_low_86
Description: NF0750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0750_low_86
NF0750_low_86
[»] chr4 (1 HSPs)
chr4 (29-248)||(20873588-20873808)


Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 29 - 248
Target Start/End: Original strand, 20873588 - 20873808
Alignment:
29 atagaccgcacgagtagtccttgtagtgacttaattaataaggcaaaccttgtggcttgtactcttagatataaacatatgagaggatatgatatgagga 128  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
20873588 atagaccgcacgagtagtccttgtagtgacttaattaataaggcaaaccttgtggcttgtactcttagatataaacatatgagtggatatgatatgagga 20873687  T
129 caatataatagttatttgaagcacatggcaggaaatttaaaagcttagttacgaggtaccaaagaaatagttagtgataaggaatataaattgtaa-gtt 227  Q
    ||||| ||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
20873688 caatacaatagttatttgaagcacatggcagcaaatttcaaagcttagttacgaggtaccaaagaaatagttagtgataaggaatataaattgtaaggtt 20873787  T
228 acttcgaattagaattaactt 248  Q
    ||||||||||||||| |||||    
20873788 acttcgaattagaatcaactt 20873808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 5098 times since January 2019
Visitors: 4845