View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0750_low_86 (Length: 248)
Name: NF0750_low_86
Description: NF0750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0750_low_86 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 29 - 248
Target Start/End: Original strand, 20873588 - 20873808
Alignment:
Q |
29 |
atagaccgcacgagtagtccttgtagtgacttaattaataaggcaaaccttgtggcttgtactcttagatataaacatatgagaggatatgatatgagga |
128 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
20873588 |
atagaccgcacgagtagtccttgtagtgacttaattaataaggcaaaccttgtggcttgtactcttagatataaacatatgagtggatatgatatgagga |
20873687 |
T |
 |
Q |
129 |
caatataatagttatttgaagcacatggcaggaaatttaaaagcttagttacgaggtaccaaagaaatagttagtgataaggaatataaattgtaa-gtt |
227 |
Q |
|
|
||||| ||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
T |
20873688 |
caatacaatagttatttgaagcacatggcagcaaatttcaaagcttagttacgaggtaccaaagaaatagttagtgataaggaatataaattgtaaggtt |
20873787 |
T |
 |
Q |
228 |
acttcgaattagaattaactt |
248 |
Q |
|
|
||||||||||||||| ||||| |
|
|
T |
20873788 |
acttcgaattagaatcaactt |
20873808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5098 times since January 2019
Visitors: 4845