View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0750_low_99 (Length: 234)
Name: NF0750_low_99
Description: NF0750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0750_low_99 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 26 - 234
Target Start/End: Complemental strand, 41190006 - 41189798
Alignment:
| Q |
26 |
aacacgctggaaaaatatgttgtcacacaccactaaagtgaaatttattcgcactttaacacaaagcattttgcagatcctgacaaatggagaggaatga |
125 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41190006 |
aacacgctggaaaaatatgttgtcacaccccactaaagtgaaatttattcgcactttaacacaaagcattttgcagatcctgacaaatggagaggaatga |
41189907 |
T |
 |
| Q |
126 |
gttggttattatgtgtaagtatcaaataattttatttgctttattgtgtttggcagctataaggatagaagcttcaatatctcagtgtgatcaagattta |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41189906 |
gttggttattatgtgtaagtatcaaataattttatttgctttattgtgtttggcagctataaggatagaagcttcaatatctcagtgtgatcaagattta |
41189807 |
T |
 |
| Q |
226 |
tgtatctta |
234 |
Q |
| |
|
||||||||| |
|
|
| T |
41189806 |
tgtatctta |
41189798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University