View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0751_low_10 (Length: 273)
Name: NF0751_low_10
Description: NF0751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0751_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 143
Target Start/End: Complemental strand, 42324782 - 42324640
Alignment:
| Q |
1 |
agataccaaagccaaatataggtatacacaggtttgtgtttgttctattcaaacaaaagaatagagaatcagtgacagcatcaccatcttcaagggatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42324782 |
agataccaaagccaaatataggtatacacaggtttgtgtttgttctattcaaacaaaagaatagagaatcagtgacagcatcaccatcttcaagggatta |
42324683 |
T |
 |
| Q |
101 |
cttcaacactcgcaattttgcttcacagaatgatcttggtctc |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42324682 |
cttcaacactcgcaattttgcttcacagaatgatcttggtctc |
42324640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University