View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0751_low_13 (Length: 256)

Name: NF0751_low_13
Description: NF0751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0751_low_13
NF0751_low_13
[»] chr5 (1 HSPs)
chr5 (28-101)||(12522478-12522551)


Alignment Details
Target: chr5 (Bit Score: 74; Significance: 5e-34; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 28 - 101
Target Start/End: Complemental strand, 12522551 - 12522478
Alignment:
28 cacagagcttttaccagaaccactttgtcccactaaggcaacacttttgcctgaaggaactcttagactaaaat 101  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12522551 cacagagcttttaccagaaccactttgtcccactaaggcaacacttttgcctgaaggaactcttagactaaaat 12522478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 4617 times since January 2019
Visitors: 4836