View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0751_low_13 (Length: 256)
Name: NF0751_low_13
Description: NF0751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0751_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 74; Significance: 5e-34; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 28 - 101
Target Start/End: Complemental strand, 12522551 - 12522478
Alignment:
Q |
28 |
cacagagcttttaccagaaccactttgtcccactaaggcaacacttttgcctgaaggaactcttagactaaaat |
101 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12522551 |
cacagagcttttaccagaaccactttgtcccactaaggcaacacttttgcctgaaggaactcttagactaaaat |
12522478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University