View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0751_low_15 (Length: 246)
Name: NF0751_low_15
Description: NF0751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0751_low_15 |
 |  |
|
[»] scaffold0098 (1 HSPs) |
 |  |  |
|
[»] scaffold0496 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 52; Significance: 6e-21; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 85 - 156
Target Start/End: Complemental strand, 12840754 - 12840683
Alignment:
Q |
85 |
agagagagtggctagagctattggacggccaaggatgcttggaactttaagattcaacatttctcttatgtt |
156 |
Q |
|
|
|||||||||||| || ||||||||||||||||||||||||||||| |||||||||||| |||||||||||| |
|
|
T |
12840754 |
agagagagtggccggacctattggacggccaaggatgcttggaactctaagattcaacacttctcttatgtt |
12840683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 147 - 237
Target Start/End: Complemental strand, 12840652 - 12840562
Alignment:
Q |
147 |
ctcttatgttgggattggatgtaaattggtaggagtctatgcaatactcttaatctgactgattgtatatgatttatgttctcagtataat |
237 |
Q |
|
|
||||| |||||||||||||||||||| |||||||| |||| |||| ||||| |||| ||| |||||||||||||||||||||| |||||| |
|
|
T |
12840652 |
ctcttgtgttgggattggatgtaaataggtaggagcctatataataatcttagtctggctggttgtatatgatttatgttctcaatataat |
12840562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 153 - 226
Target Start/End: Complemental strand, 7566564 - 7566491
Alignment:
Q |
153 |
tgttgggattggatgtaaattggtaggagtctatgcaatactcttaatctgactgattgtatatgatttatgtt |
226 |
Q |
|
|
|||||||||||||||||||| | ||||| ||||| | || ||| |||||||||| |||||||||||||||||| |
|
|
T |
7566564 |
tgttgggattggatgtaaatagctaggaacctatgtagtagtctaaatctgactggttgtatatgatttatgtt |
7566491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0098 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: scaffold0098
Description:
Target: scaffold0098; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 144 - 233
Target Start/End: Original strand, 3293 - 3382
Alignment:
Q |
144 |
tttctcttatgttgggattggatgtaaattggtaggagtctatgcaatactcttaatctgactgattgtatatgatttatgttctcagta |
233 |
Q |
|
|
||||| ||||||||||||||||||||||| ||||| | |||||| | |||||||||| | ||| | |||||||||||||||||||||| |
|
|
T |
3293 |
tttcttttatgttgggattggatgtaaataggtagaaatctatgtagtactcttaattcggctggatatatatgatttatgttctcagta |
3382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 150 - 224
Target Start/End: Complemental strand, 26280164 - 26280090
Alignment:
Q |
150 |
ttatgttgggattggatgtaaattggtaggagtctatgcaatactcttaatctgactgattgtatatgatttatg |
224 |
Q |
|
|
|||| |||||||| ||||||||| ||||| |||||| | |||||||||||||||| |||| |||||||||||| |
|
|
T |
26280164 |
ttatattgggattagatgtaaatatctaggattctatgtattactcttaatctgactaattgcatatgatttatg |
26280090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 153 - 224
Target Start/End: Complemental strand, 8718123 - 8718052
Alignment:
Q |
153 |
tgttgggattggatgtaaattggtaggagtctatgcaatactcttaatctgactgattgtatatgatttatg |
224 |
Q |
|
|
|||||||||||||||||||| | ||||| | |||||| |||||||||| || ||| |||||| |||||||| |
|
|
T |
8718123 |
tgttgggattggatgtaaatagttaggattttatgcagtactcttaatatggctggttgtattcgatttatg |
8718052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0496 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0496
Description:
Target: scaffold0496; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 165 - 229
Target Start/End: Original strand, 9624 - 9688
Alignment:
Q |
165 |
atgtaaattggtaggagtctatgcaatactcttaatctgactgattgtatatgatttatgttctc |
229 |
Q |
|
|
|||||||| | || || |||||| |||||||||| ||| ||| ||||||||||||||||||||| |
|
|
T |
9624 |
atgtaaatagctacgaatctatgtaatactcttagtctcgctgtttgtatatgatttatgttctc |
9688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 87 - 143
Target Start/End: Complemental strand, 319514 - 319458
Alignment:
Q |
87 |
agagagtggctagagctattggacggccaaggatgcttggaactttaagattcaaca |
143 |
Q |
|
|
||||||||||| |||| |||||| ||||||||||||| ||||| ||||||||||| |
|
|
T |
319514 |
agagagtggctggagccattggagagccaaggatgctttgaactacaagattcaaca |
319458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3881 times since January 2019
Visitors: 4823