View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0751_low_7 (Length: 315)
Name: NF0751_low_7
Description: NF0751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0751_low_7 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 147 - 315
Target Start/End: Complemental strand, 5600057 - 5599884
Alignment:
| Q |
147 |
tattatacaagtattaacacgcaaaaa---ttgcactctcaattttccc-atctaacttacttacactaggcatgaaaatgtgtattaaagttttattag |
242 |
Q |
| |
|
||||||| |||| ||||||| |||||| ||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5600057 |
tattataaaagttttaacacacaaaaaatattgcactctcaattttccccatctaatttacttacactaggcatgaaaatgtgtattaaagttttattag |
5599958 |
T |
 |
| Q |
243 |
tctcatattgtcaaggttcttagcttgttaaatatttgtgcttaggcactcatattc-tttaagtcaaatttta |
315 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5599957 |
tctcatattgtcaaggttcctagtttgttaaatatttgtgcttaggcactcatattcttttaagtcaaatttta |
5599884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 102 - 144
Target Start/End: Original strand, 33848312 - 33848354
Alignment:
| Q |
102 |
tcaacggtgaatttcggggtaaagaataagtgaggcgaactct |
144 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
33848312 |
tcaactgtgaatttcggtgtaaagaataagtgaggcgagctct |
33848354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 102 - 144
Target Start/End: Complemental strand, 1740899 - 1740857
Alignment:
| Q |
102 |
tcaacggtgaatttcggggtaaagaataagtgaggcgaactct |
144 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
1740899 |
tcaactgtgaatttcggtgtaaagaataagtgagacgaactct |
1740857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 83 - 144
Target Start/End: Original strand, 31987012 - 31987073
Alignment:
| Q |
83 |
aggaaaagcaccggaaatatcaacggtgaatttcggggtaaagaataagtgaggcgaactct |
144 |
Q |
| |
|
||||||| ||| |||| |||||| ||||| ||||| |||||||||||||||||||| |||| |
|
|
| T |
31987012 |
aggaaaaacacaagaaacatcaactgtgaacttcggcgtaaagaataagtgaggcgagctct |
31987073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University