View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0751_low_9 (Length: 275)
Name: NF0751_low_9
Description: NF0751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0751_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 144; Significance: 9e-76; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 144; E-Value: 9e-76
Query Start/End: Original strand, 38 - 223
Target Start/End: Original strand, 34097774 - 34097961
Alignment:
Q |
38 |
gaacctgtgacc-ctcaataattcacattaaagagaaatttgtagcaaataaatcatttgataaatataaggaaaaaacagtctgttttagacatg-ata |
135 |
Q |
|
|
|||||| ||||| |||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |||||| ||| |
|
|
T |
34097774 |
gaacctttgacctctcaataatttacattaaagagaaatttgtagcaaataaatcatttgacaaatataaggaaaaaacagtcggttttggacatggata |
34097873 |
T |
 |
Q |
136 |
tatggcttaacctaaatattatttaaacttagattaggaattcaagtgttttcacttggacgttgagggtttctctagaggtgtcaat |
223 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
34097874 |
tatggcctaacctaaatattatttaaacttagattaggaattcaagtgttttcacttggacgttgagggtttctctagagatgtcaat |
34097961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3501 times since January 2019
Visitors: 4814