View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0752-Insertion-13 (Length: 367)
Name: NF0752-Insertion-13
Description: NF0752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0752-Insertion-13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 9e-89; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 9e-89
Query Start/End: Original strand, 37 - 252
Target Start/End: Original strand, 20279625 - 20279847
Alignment:
| Q |
37 |
ttcttttgaggttttctacctggccacgtacaatccttctcatacctttcaacttctttcttagatcgacaaatcagattgggtacatgtttgtgaatat |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20279625 |
ttcttttgaggttttctacctggccacgtaccatccttctcatacctttcaacttctttcttagatcgacaaatcagattgggtacatgtttgtgaatat |
20279724 |
T |
|
| Q |
137 |
agaactgtaaaagatcaatgttatgacattcattgcattatttcaaatggaagataccaat-aaact--aaatgaatcaacatataataa---ataaatt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| ||||||||||| ||||||||| | ||||| |
|
|
| T |
20279725 |
agaactgtaaaagatcaatgttatgacattcattgcattatttcaaatggaaaataccaataaaactaaaaatgaatcaaaatataataaaataaaaatt |
20279824 |
T |
|
| Q |
231 |
ataaattagatca-tatgagaaa |
252 |
Q |
| |
|
||||||||||||| ||||||||| |
|
|
| T |
20279825 |
ataaattagatcattatgagaaa |
20279847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 8 - 38
Target Start/End: Original strand, 20279564 - 20279594
Alignment:
| Q |
8 |
caaacaacatgttgaagtatatactaacctt |
38 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
20279564 |
caaacaacatgttgaagtatatactaacctt |
20279594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2845 times since January 2019
Visitors: 4801