View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0752-Insertion-19 (Length: 92)
Name: NF0752-Insertion-19
Description: NF0752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0752-Insertion-19 |
 |  |
|
[»] chr4 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 86; Significance: 1e-41; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 86; E-Value: 1e-41
Query Start/End: Original strand, 7 - 92
Target Start/End: Complemental strand, 16855593 - 16855508
Alignment:
Q |
7 |
agttaggattggagactggtctctttgaggtcttccatagtcttggtgttgggaggagggtcgggttaggtttgttgttggtttga |
92 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
16855593 |
agttaggattggagactggtctctttgaggtcttccatagtcttggtgttgggaggagggtcgggttaggtttgttgttggtttga |
16855508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 1e-22
Query Start/End: Original strand, 23 - 92
Target Start/End: Complemental strand, 17523766 - 17523697
Alignment:
Q |
23 |
tggtctctttgaggtcttccatagtcttggtgttgggaggagggtcgggttaggtttgttgttggtttga |
92 |
Q |
|
|
||||||||| ||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
17523766 |
tggtctcttcgaggtcttccaaagtcttggtgttgggaggagggtcaagttaggtttgttgttggtttga |
17523697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.00000000003
Query Start/End: Original strand, 26 - 64
Target Start/End: Complemental strand, 17513867 - 17513829
Alignment:
Q |
26 |
tctctttgaggtcttccatagtcttggtgttgggaggag |
64 |
Q |
|
|
||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
17513867 |
tctctttaaggtcttccatagtcttggtgttgggaggag |
17513829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University