View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0752-Insertion-20 (Length: 54)
Name: NF0752-Insertion-20
Description: NF0752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0752-Insertion-20 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 44; Significance: 6e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 6e-17
Query Start/End: Original strand, 7 - 54
Target Start/End: Original strand, 53447059 - 53447106
Alignment:
Q |
7 |
agctcaaggatatggaattaaaaacacaagcatgagatcatcacactc |
54 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
53447059 |
agctcaaggatatggaattgaaaacacaagcatgagatcatcacactc |
53447106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University