View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0752-Insertion-23 (Length: 428)
Name: NF0752-Insertion-23
Description: NF0752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0752-Insertion-23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 4e-85; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 4e-85
Query Start/End: Original strand, 8 - 179
Target Start/End: Complemental strand, 11035727 - 11035556
Alignment:
| Q |
8 |
ccttactctctccactggtggaaacacgtcggagctcaagtttcactgtgtcgacgtggatctctggtaacggtggcgcgtggatgatctcttggatttc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11035727 |
ccttactctctccactggtggaaacacgtcggagctcaagcttcactgtgtcgacgtggatctctggtaacggtggcgcgtggatgatctcttggatttc |
11035628 |
T |
|
| Q |
108 |
cttggaaactacgggagtgaagtgggtgagcttggtgggtttatggtggtttttgcggcggcggtgggaggt |
179 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
11035627 |
cttggagactacgggagtgaagtgggtgagcttggttggtttatggtggtttttgcggcggcggtgggaggt |
11035556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 222 - 329
Target Start/End: Complemental strand, 11035513 - 11035406
Alignment:
| Q |
222 |
accgacgaggattccgatgacaaccctgagacggagaccgaagattgatgnnnnnnnggagagttgtgtgtcgatgaatgctgcatcgtatactgacatg |
321 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11035513 |
accgacgaggattccgatgacaacccagagacggagaccgaagattgatgtttttttggatagttgtgtgtcgatgaatgctgcatcgtatactgacatg |
11035414 |
T |
|
| Q |
322 |
atgatgat |
329 |
Q |
| |
|
| |||||| |
|
|
| T |
11035413 |
acgatgat |
11035406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2751 times since January 2019
Visitors: 4801