View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0752_high_4 (Length: 347)
Name: NF0752_high_4
Description: NF0752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0752_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 231
Target Start/End: Complemental strand, 49070569 - 49070356
Alignment:
| Q |
18 |
aagattcccaacatacaccttatgaggaccttcatagtatattgttcttcttctcatgggaggcgagttcaatgtctcaacagaaaatttaaccagcatt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49070569 |
aagattcccaacatacaccttatgaggaccttcatagtatattgttcttcttctcataggaggcgagttcaatgtctcaacagaaaatttaaccagcatt |
49070470 |
T |
 |
| Q |
118 |
tcacgcccaccaacatccttcaattgaaacggaaaacaaagtttcattattaagataaaaacaaatagatatgatagtgactaaccgatccatccaatgc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
49070469 |
tcacgcccaccaacatccttcaattgaaacggaaaacaaagtttcattattaagataaaaacaaatagatatgatagtgactaaccgatccatccaacgc |
49070370 |
T |
 |
| Q |
218 |
aacaagtgcatttt |
231 |
Q |
| |
|
| |||||||||||| |
|
|
| T |
49070369 |
agcaagtgcatttt |
49070356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University