View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0752_low_14 (Length: 315)
Name: NF0752_low_14
Description: NF0752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0752_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 76 - 287
Target Start/End: Original strand, 43392370 - 43392581
Alignment:
Q |
76 |
cagaacctgtgacatataaatacatgcatattctataatagtttttctatgccataatttcaaccaacaatagagaaaatggttgaaagagagtgtgttg |
175 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43392370 |
cagaacctgtgacatataaatacatgcatattctataatagtttttctatgccataatttcaaccaacaatagagaaaatggttgaaagagagtgtgttg |
43392469 |
T |
 |
Q |
176 |
gcaacagttctcttcaattgaaactctatacaaccctaacattgacggatgttcataaattcatgtcatcaacaactgtacggtcaaagtataggcaaaa |
275 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
43392470 |
gcaacagttctcttcaattgaaactctatacaaccctaacattgacggatgttcataaattcatgtcatcaacaattgtacggtcaaagtataggcaaaa |
43392569 |
T |
 |
Q |
276 |
tgtgggtgtctg |
287 |
Q |
|
|
|||| ||||||| |
|
|
T |
43392570 |
tgtgtgtgtctg |
43392581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University