View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0752_low_16 (Length: 312)
Name: NF0752_low_16
Description: NF0752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0752_low_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 39 - 305
Target Start/End: Complemental strand, 9073289 - 9073024
Alignment:
| Q |
39 |
gattcacaacactatgacaattaatgctagaatttaaatctaatcacttctactttcttcaggtgccggcgttaacttttctaggtgccttgaatctgct |
138 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
9073289 |
gattcacaacactatgacaat-aatgctagaatttaaatctaatcacttctactttcttcaggtgtcgacgttaacttttctaggtgccttgaatctgct |
9073191 |
T |
 |
| Q |
139 |
tcattcaccggatacaagaattcattcagacgtcgcaaaaccaagaaaagaatttgtgatttatgttgggagaaagcttttgcaggtaaattaatacaaa |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9073190 |
tcattcaccggatacaagaattcattcagatgttgcaaaaccaagaaaagaatttgtgatttatgttgggagaaagcttttgcaggtaacttaatacaaa |
9073091 |
T |
 |
| Q |
239 |
tcacaannnnnnnncacacttggaggaatttcaaaacatcgttttcagtgtttctgaatattcttcg |
305 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |||||||| ||||||| |||| |
|
|
| T |
9073090 |
tcacaatttttttacacacttggaggaatttcaaaacatcgtttttagtgtttccgaatatttttcg |
9073024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 9073397 - 9073351
Alignment:
| Q |
1 |
atagggtagcacaatttaacaaatcgcttttgttctgcgattcacaa |
47 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9073397 |
atagcgtagcacaatttaacaaatcgcttttgttctgcgattcacaa |
9073351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University