View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0752_low_19 (Length: 293)
Name: NF0752_low_19
Description: NF0752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0752_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 52; Significance: 7e-21; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 140 - 219
Target Start/End: Original strand, 30654067 - 30654146
Alignment:
Q |
140 |
gatggcttcttgcgagtctatgctgagattttcgatacaattatgtctagtttttctgcatctgctttggaatctcgact |
219 |
Q |
|
|
|||||||| ||| ||||||||||||||||||||||||||||| |||||||||||||||| |||||| | |||||||||| |
|
|
T |
30654067 |
gatggcttgttgggagtctatgctgagattttcgatacaattctgtctagtttttctgcctctgctgcgcaatctcgact |
30654146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 17 - 83
Target Start/End: Original strand, 10868751 - 10868817
Alignment:
Q |
17 |
tgtagggatgatatatatgtagtataatccagcttcaattttgtgagttatgtgattagaactataa |
83 |
Q |
|
|
||||||| || |||||||| | ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
10868751 |
tgtagggctggtatatatgcaatataatccagcttcagttttgtgagttatgtgattagaactataa |
10868817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3335 times since January 2019
Visitors: 4812