View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0752_low_19 (Length: 293)

Name: NF0752_low_19
Description: NF0752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0752_low_19
NF0752_low_19
[»] chr5 (2 HSPs)
chr5 (140-219)||(30654067-30654146)
chr5 (17-83)||(10868751-10868817)


Alignment Details
Target: chr5 (Bit Score: 52; Significance: 7e-21; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 140 - 219
Target Start/End: Original strand, 30654067 - 30654146
Alignment:
140 gatggcttcttgcgagtctatgctgagattttcgatacaattatgtctagtttttctgcatctgctttggaatctcgact 219  Q
    |||||||| ||| ||||||||||||||||||||||||||||| |||||||||||||||| ||||||  | ||||||||||    
30654067 gatggcttgttgggagtctatgctgagattttcgatacaattctgtctagtttttctgcctctgctgcgcaatctcgact 30654146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 17 - 83
Target Start/End: Original strand, 10868751 - 10868817
Alignment:
17 tgtagggatgatatatatgtagtataatccagcttcaattttgtgagttatgtgattagaactataa 83  Q
    ||||||| || |||||||| | ||||||||||||||| |||||||||||||||||||||||||||||    
10868751 tgtagggctggtatatatgcaatataatccagcttcagttttgtgagttatgtgattagaactataa 10868817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University