View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0752_low_21 (Length: 280)
Name: NF0752_low_21
Description: NF0752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0752_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 58 - 239
Target Start/End: Complemental strand, 40543126 - 40542945
Alignment:
| Q |
58 |
aaccataacctttgagataagcttgagaagaatgttataaaggataatcgtcctaaaggccatcaaactttgaggtttattactcttaggaattggaaca |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40543126 |
aaccataacctttgagataagcttgagaagaatgttataaaggatagtcgtcctaaaggccatcaaactttgaggtttattactcttaggaattggaaca |
40543027 |
T |
 |
| Q |
158 |
ataagagtctatgtcaacttaggagggataataccaatattaaaacactccaaaacaagctttcaaacaatataactcccta |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40543026 |
ataagagtctatgtcaacttaggagggataataccaatattaaaacactccaaaacaagctttcaaacaatataactcccta |
40542945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University