View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0752_low_24 (Length: 236)
Name: NF0752_low_24
Description: NF0752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0752_low_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 1 - 168
Target Start/End: Complemental strand, 21194331 - 21194164
Alignment:
Q |
1 |
ttgccatggtgtgtgaacaagggagtgatccactttctaatattgttggatttattaaaccatctacacttgtcattggtcctgaaagtagcattggtgc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
T |
21194331 |
ttgccatggtgtgtgaacaagggagtgatccactttctaatattgttggatttattaaaccatctacacttgtcattggtcctgaaagtagcattgatgc |
21194232 |
T |
 |
Q |
101 |
tgctgatgttgttgttgatgccattgcttttgctgttggtggtagagcatggttatgttgtccttcat |
168 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
21194231 |
tgctgatgttgttgttgatgccattgcttttgctgttggtggtagagcatggttatgttgtccttcat |
21194164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 60 - 168
Target Start/End: Original strand, 8496882 - 8496990
Alignment:
Q |
60 |
ccatctacacttgtcattggtcctgaaagtagcattggtgctgctgatgttgttgttgatgccattgcttttgctgttggtggtagagcatggttatgtt |
159 |
Q |
|
|
|||||| |||||| ||||| |||||| |||| ||| |||||||| || ||||||||||||||||| | |||| ||||||||| | |||||||||| |
|
|
T |
8496882 |
ccatctgcacttgacattgatcctgatagtaacatgcttgctgctgctgaagttgttgatgccattgccatagctgctggtggtagtggatggttatgtg |
8496981 |
T |
 |
Q |
160 |
gtccttcat |
168 |
Q |
|
|
|||||||| |
|
|
T |
8496982 |
ttccttcat |
8496990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University