View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0752_low_25 (Length: 236)
Name: NF0752_low_25
Description: NF0752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0752_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 84; Significance: 5e-40; HSPs: 11)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 13 - 104
Target Start/End: Complemental strand, 3817563 - 3817472
Alignment:
Q |
13 |
aagagacggattagccgcatgaaggttcttatcgttcttgatgatgtcaaggagacagatcagctagagatgttatttggaactctcgattg |
104 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| |
|
|
T |
3817563 |
aagagacggattagccgcatgaaggttcttatcgttcttgatgatgtcaaggagacagatcagctcgagatgttatttggaactcttgattg |
3817472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 13 - 104
Target Start/End: Original strand, 3919901 - 3919992
Alignment:
Q |
13 |
aagagacggattagccgcatgaaggttcttatcgttcttgatgatgtcaaggagacagatcagctagagatgttatttggaactctcgattg |
104 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| |
|
|
T |
3919901 |
aagagacggattagccgcatgaaggttcttatcgttcttgatgatgtcaaggagacagatcagctcgagatgttatttggaactcttgattg |
3919992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 14 - 104
Target Start/End: Original strand, 3933126 - 3933216
Alignment:
Q |
14 |
agagacggattagccgcatgaaggttcttatcgttcttgatgatgtcaaggagacagatcagctagagatgttatttggaactctcgattg |
104 |
Q |
|
|
|||||||||| |||||||||| |||||||| ||||||||||||||||| || ||||||| ||||||||||||||||||| |||| ||||| |
|
|
T |
3933126 |
agagacggatcggccgcatgaaagttcttattgttcttgatgatgtcaatgaaacagatctgctagagatgttatttggatctcttgattg |
3933216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 14 - 94
Target Start/End: Complemental strand, 3809982 - 3809902
Alignment:
Q |
14 |
agagacggattagccgcatgaaggttcttatcgttcttgatgatgtcaaggagacagatcagctagagatgttatttggaa |
94 |
Q |
|
|
|||| |||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||| || | |||||||||| |
|
|
T |
3809982 |
agaggcggattggccgcatgaaggttcttatcgttcttgatgacgtcaagggtacagatcagctggaaaaattatttggaa |
3809902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 14 - 98
Target Start/End: Complemental strand, 3986961 - 3986877
Alignment:
Q |
14 |
agagacggattagccgcatgaaggttcttatcgttcttgatgatgtcaaggagacagatcagctagagatgttatttggaactct |
98 |
Q |
|
|
||||||| ||| | |||||||||||||||||| ||||||||||||| ||||| ||||||||||||||||||||| | |||||| |
|
|
T |
3986961 |
agagacgaattggacgcatgaaggttcttatcattcttgatgatgttaaggacgaagatcagctagagatgttattcgaaactct |
3986877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 31 - 104
Target Start/End: Complemental strand, 4009945 - 4009872
Alignment:
Q |
31 |
atgaaggttcttatcgttcttgatgatgtcaaggagacagatcagctagagatgttatttggaactctcgattg |
104 |
Q |
|
|
|||||||||||||| |||||||||||||| ||||| || ||||||||||||||||||| ||||||| ||||| |
|
|
T |
4009945 |
atgaaggttcttattgttcttgatgatgttaaggaagaaggtcagctagagatgttatttagaactcttgattg |
4009872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 21 - 104
Target Start/End: Complemental strand, 4002258 - 4002175
Alignment:
Q |
21 |
gattagccgcatgaaggttcttatcgttcttgatgatgtcaaggagacagatcagctagagatgttatttggaactctcgattg |
104 |
Q |
|
|
|||| |||| |||||||||||||| |||||||||||||| ||||| || ||| |||||||||||||||||||||| ||||| |
|
|
T |
4002258 |
gattggccgtatgaaggttcttattgttcttgatgatgttaaggaagaaggtcaaatagagatgttatttggaactcttgattg |
4002175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 31 - 104
Target Start/End: Complemental strand, 4218592 - 4218519
Alignment:
Q |
31 |
atgaaggttcttatcgttcttgatgatgtcaaggagacagatcagctagagatgttatttggaactctcgattg |
104 |
Q |
|
|
|||||||||||||| |||||||||||| | ||||| || || |||||||||||||||||||||||| ||||| |
|
|
T |
4218592 |
atgaaggttcttattgttcttgatgatattaaggaagaaggtctgctagagatgttatttggaactcttgattg |
4218519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 20 - 104
Target Start/End: Complemental strand, 3801546 - 3801462
Alignment:
Q |
20 |
ggattagccgcatgaaggttcttatcgttcttgatgatgtcaaggagacagatcagctagagatgttatttggaactctcgattg |
104 |
Q |
|
|
||||| |||| |||||||||||||| | |||||||||| | ||||| || || |||||||||||||||||||||||| ||||| |
|
|
T |
3801546 |
ggattggccgtatgaaggttcttattgatcttgatgatattaaggaagaaggtctgctagagatgttatttggaactcttgattg |
3801462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 14 - 104
Target Start/End: Complemental strand, 4025192 - 4025102
Alignment:
Q |
14 |
agagacggattagccgcatgaaggttcttatcgttcttgatgatgtcaaggagacagatcagctagagatgttatttggaactctcgattg |
104 |
Q |
|
|
||||| ||||| |||| |||||||| ||||| ||||||||||| || ||||| || |||| ||||||||||||||||||| || ||||| |
|
|
T |
4025192 |
agagaaggattggccgtatgaaggtccttattgttcttgatgacgttaaggaagaaggtcagatagagatgttatttggaacacttgattg |
4025102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 14 - 59
Target Start/End: Original strand, 3954565 - 3954610
Alignment:
Q |
14 |
agagacggattagccgcatgaaggttcttatcgttcttgatgatgt |
59 |
Q |
|
|
||||| ||||| |||| |||||||||||||| |||||||||||||| |
|
|
T |
3954565 |
agagaaggattggccgtatgaaggttcttattgttcttgatgatgt |
3954610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 14 - 104
Target Start/End: Complemental strand, 13397916 - 13397826
Alignment:
Q |
14 |
agagacggattagccgcatgaaggttcttatcgttcttgatgatgtcaaggagacagatcagctagagatgttatttggaactctcgattg |
104 |
Q |
|
|
||||| ||||| ||| |||||||||||||| |||||||||||||| | ||| || |||||| |||||||||||||||||||| ||||| |
|
|
T |
13397916 |
agagaaggattggccatatgaaggttcttattgttcttgatgatgttacggaagaaggtcagctggagatgttatttggaactcttgattg |
13397826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 23 - 62
Target Start/End: Complemental strand, 7075456 - 7075417
Alignment:
Q |
23 |
ttagccgcatgaaggttcttatcgttcttgatgatgtcaa |
62 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
7075456 |
ttagccgcatgaaggttcttattgttcttgatgatgtcaa |
7075417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 26 - 62
Target Start/End: Original strand, 7023411 - 7023447
Alignment:
Q |
26 |
gccgcatgaaggttcttatcgttcttgatgatgtcaa |
62 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||| |
|
|
T |
7023411 |
gccgcatgaaggttcttattgttcttgatgatgtcaa |
7023447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 59
Target Start/End: Original strand, 7036508 - 7036542
Alignment:
Q |
25 |
agccgcatgaaggttcttatcgttcttgatgatgt |
59 |
Q |
|
|
|||||||||||||||||||| |||||||||||||| |
|
|
T |
7036508 |
agccgcatgaaggttcttattgttcttgatgatgt |
7036542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2836 times since January 2019
Visitors: 4801