View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0752_low_26 (Length: 217)
Name: NF0752_low_26
Description: NF0752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0752_low_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 1 - 140
Target Start/End: Original strand, 18352819 - 18352958
Alignment:
| Q |
1 |
tgtgaaggatcctaattatggtggttagaaagaactaagaacattttgttcatactattttggaaaataaaccttttgtatatttgtgcatgtgtaatct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18352819 |
tgtgaaggatcctaattatggtggttagaaagaactatgaacattttgttcatactattttggaaaataaaccttttgtatatttgtgcatgtgtaatct |
18352918 |
T |
 |
| Q |
101 |
tacgagtaatgccagctgataacactcattttagtataat |
140 |
Q |
| |
|
||||||||||||||| | || |||||||||||| |||||| |
|
|
| T |
18352919 |
tacgagtaatgccagttaatgacactcattttaatataat |
18352958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University