View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0752_low_6 (Length: 446)
Name: NF0752_low_6
Description: NF0752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0752_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 202 - 417
Target Start/End: Complemental strand, 38951840 - 38951624
Alignment:
| Q |
202 |
agagcatatgtgtaacacacaaggcttccatagccatgcaagctgaagaatgtctaatgctcagcaccccacctgctttaacgtgtccattcatcaccat |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38951840 |
agagcatatgtgtaacacacaaggcttccatagccatgcaagctgaagaatgtctaatgctcagcaccccacctgctttaacgtgtccattcatcaccat |
38951741 |
T |
|
| Q |
302 |
tctcacttccc-tataaattaccagttctcattgaggttctcctcatcacaaacaacagtcctccaatatctgtcatcatggctaagcttcttgcactct |
400 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38951740 |
tctcacttcccttataaattaccagttctcattgaggttctcctcatcacaaacaacagtcctccaatatctgtcatcatggctaagcttcttgcactct |
38951641 |
T |
|
| Q |
401 |
ctctttcactttgtttt |
417 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
38951640 |
ctctttcactttgtttt |
38951624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 11 - 202
Target Start/End: Complemental strand, 38952057 - 38951865
Alignment:
| Q |
11 |
cagagaccgtgattgttaaatgaagtagctaattgaaaatctttcttcatgaatcttt-gcatgctgtgcataatttataaggaagaagcgtggacgaca |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38952057 |
cagagaccgtgattgttaaatgaagtagctaattgaaaatctttcttcatgaatcttttgcatgctgtgcataatttataaggaagaagcgtggacgaca |
38951958 |
T |
|
| Q |
110 |
agaaataaagccatggtcccctcaccactgattccagctaatagcacgtaggcaagaattgcaatgcagacaatcatgctctttgtttggtta |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38951957 |
agaaataaagccatggtcccctcaccactgattccagctaatagcacgtaggcaagaattgcaatgcagacaatcatgctctttgtttggtta |
38951865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 376 - 406
Target Start/End: Complemental strand, 38944166 - 38944136
Alignment:
| Q |
376 |
atcatggctaagcttcttgcactctctcttt |
406 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
38944166 |
atcatggctaagcttcttgcactctctcttt |
38944136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 219 - 265
Target Start/End: Complemental strand, 38944337 - 38944291
Alignment:
| Q |
219 |
cacaaggcttccatagccatgcaagctgaagaatgtctaatgctcag |
265 |
Q |
| |
|
|||| ||||| |||||||||||| | ||||||||||||||||||||| |
|
|
| T |
38944337 |
cacatggctttcatagccatgcacgatgaagaatgtctaatgctcag |
38944291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3323 times since January 2019
Visitors: 4812