View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0753_high_14 (Length: 313)
Name: NF0753_high_14
Description: NF0753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0753_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 77; Significance: 1e-35; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 26661787 - 26661676
Alignment:
Q |
1 |
ttttgtaaaattgaattcaatcgcgcaaagatcttttttcttgaaacttcatcttagtttcacatcaatcggtatcatggagtcataaccaccatctttg |
100 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
26661787 |
ttttgaaaaattgaattcaatcgcgcaaagatcttttttcttgaaacttcatctta-------------cggtatcatggagtcataaccaccatctttg |
26661701 |
T |
 |
Q |
101 |
atagcaatttaaaaaattcaagaaa |
125 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
26661700 |
atagcaatttaaaaaattcaagaaa |
26661676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5000 times since January 2019
Visitors: 4844