View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0753_high_20 (Length: 271)
Name: NF0753_high_20
Description: NF0753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0753_high_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 34 - 233
Target Start/End: Original strand, 33185559 - 33185758
Alignment:
| Q |
34 |
agaaaggatgagaagagttataaacttcttcttcaagagcatagaaaggaaccattagattcttcttttcatgaatcagaaaagtacaccaaagaggatt |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33185559 |
agaaaggatgagaagagttataaacttcttcttcaagagcatagaaaggaaccattagattcttcttttcatgaatcagaaaagtgcaccaaagaggatt |
33185658 |
T |
|
| Q |
134 |
tcccataaccgtataatcttcaagctcaccagcttcttgaagaaagagtcgaacgttttcacggaacggacctgaaggtgaaattggacaaccagggtca |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33185659 |
tcccataaccgtataatcttcaagctcaccagcttcttgaagaaagagtcgaacgttttcacggaacggacctgaaggtgaaattggacaaccagggtca |
33185758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5029 times since January 2019
Visitors: 4845