View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0753_high_28 (Length: 234)

Name: NF0753_high_28
Description: NF0753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0753_high_28
NF0753_high_28
[»] chr7 (1 HSPs)
chr7 (37-182)||(46399476-46399621)


Alignment Details
Target: chr7 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 37 - 182
Target Start/End: Original strand, 46399476 - 46399621
Alignment:
37 aaggggaagatgtaattaccaagccactacaacaataagagaaaccctaaagaggagaggagtataagtataacccaagaattagaacacagattatgtt 136  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46399476 aaggggaagatgtaattaacaagccactacaacaataagagaaaccctaaagaggagaggagtataagtataacccaagaattagaacacagattatgtt 46399575  T
137 gaatagtttttgaattataacagcattggattgcaatagctggtgc 182  Q
    |||||| ||||||||| |||||||||||||||||||||||||||||    
46399576 gaatagattttgaattttaacagcattggattgcaatagctggtgc 46399621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 4955 times since January 2019
Visitors: 4844