View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0753_high_31 (Length: 208)

Name: NF0753_high_31
Description: NF0753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0753_high_31
NF0753_high_31
[»] chr1 (1 HSPs)
chr1 (1-117)||(52245636-52245752)


Alignment Details
Target: chr1 (Bit Score: 117; Significance: 8e-60; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 52245636 - 52245752
Alignment:
1 aaatgatgctttctaactgtctttttcgagcaggtggttgttccatgcttttcacaaacaaaacagaactgaaagatagagccatcttgaaactgaaaca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52245636 aaatgatgctttctaactgtctttttcgagcaggtggttgttccatgcttttcacaaacaaaacagaactgaaagatagagccatcttgaaactgaaaca 52245735  T
101 catggaaagaacacagt 117  Q
    |||||||||||||||||    
52245736 catggaaagaacacagt 52245752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University