View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0753_low_13 (Length: 343)
Name: NF0753_low_13
Description: NF0753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0753_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 1e-72; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 80 - 265
Target Start/End: Complemental strand, 3324855 - 3324670
Alignment:
| Q |
80 |
cagagattcaactgactcaagaattaagannnnnnnnnaatgatctatatgatgtaagttttaccaagttggaaacaatatcacatgcttcacggatctt |
179 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| ||||| |
|
|
| T |
3324855 |
cagagattcaactgactcaagaattaagaaacttttttgatgatctatatgatgtaagttttaccaagttcgaaacaatatcacatgcatcacgaatctt |
3324756 |
T |
 |
| Q |
180 |
agaaatttcctggagatcgcttttgattggattaggaagttgtagcatggccatcaacactcttggcaagaacatatcacaggttc |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3324755 |
agaaatttcctggagatcgcttttgattggattaggaagttgcagcatggccatcaacactcttggcaagaacatatcacaggttc |
3324670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 185 - 265
Target Start/End: Complemental strand, 3262380 - 3262300
Alignment:
| Q |
185 |
tttcctggagatcgcttttgattggattaggaagttgtagcatggccatcaacactcttggcaagaacatatcacaggttc |
265 |
Q |
| |
|
|||||| ||||||||| |||||| || |||||||||| | | | |||||| |||||||| |||| |||||||||||||| |
|
|
| T |
3262380 |
tttcctcgagatcgctattgattagaataggaagttgccacgtagtcatcaaaactcttggaaagagcatatcacaggttc |
3262300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000008; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 231 - 266
Target Start/End: Complemental strand, 12598838 - 12598803
Alignment:
| Q |
231 |
catcaacactcttggcaagaacatatcacaggttct |
266 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12598838 |
catcgacactcttggcaagaacatatcacaggttct |
12598803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 119 - 167
Target Start/End: Original strand, 20812662 - 20812710
Alignment:
| Q |
119 |
atgatctatatgatgtaagttttaccaagttggaaacaatatcacatgc |
167 |
Q |
| |
|
|||||||||||||||| | |||||| |||||||||||| ||||||||| |
|
|
| T |
20812662 |
atgatctatatgatgtgaattttactgagttggaaacaacatcacatgc |
20812710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University