View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0753_low_18 (Length: 313)
Name: NF0753_low_18
Description: NF0753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0753_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 4e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 71 - 217
Target Start/End: Original strand, 26661833 - 26661979
Alignment:
Q |
71 |
cttacatagcagattaaactagaagatgaagaccgaggtgagtgactgccacttccgtctctatttttcgtttgtgctaacatctaatctatgtcgttaa |
170 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26661833 |
cttacaaagcagattaaactagaagatgaagaccgaggtgagtgactgccacttccgtctctatttttcgtttgtgctaacatctaatctatgtcgttaa |
26661932 |
T |
 |
Q |
171 |
atcttagacaagggtgcagagtgctgaaccccaaaaccactatagtg |
217 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26661933 |
atcttagacaagggtgcagagtgctgaaccccaaaaccactatagtg |
26661979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University