View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0753_low_19 (Length: 313)

Name: NF0753_low_19
Description: NF0753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0753_low_19
NF0753_low_19
[»] chr4 (1 HSPs)
chr4 (1-125)||(26661676-26661787)


Alignment Details
Target: chr4 (Bit Score: 77; Significance: 1e-35; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 26661787 - 26661676
Alignment:
1 ttttgtaaaattgaattcaatcgcgcaaagatcttttttcttgaaacttcatcttagtttcacatcaatcggtatcatggagtcataaccaccatctttg 100  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||             |||||||||||||||||||||||||||||||    
26661787 ttttgaaaaattgaattcaatcgcgcaaagatcttttttcttgaaacttcatctta-------------cggtatcatggagtcataaccaccatctttg 26661701  T
101 atagcaatttaaaaaattcaagaaa 125  Q
    |||||||||||||||||||||||||    
26661700 atagcaatttaaaaaattcaagaaa 26661676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University