View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0753_low_21 (Length: 295)
Name: NF0753_low_21
Description: NF0753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0753_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 61 - 237
Target Start/End: Complemental strand, 48414911 - 48414735
Alignment:
| Q |
61 |
atatgatggaagagacagaagggggcgaatgatccagcatgccagttacatagatgaatcgagtcttaggattcatggtaaagagttatccagcaagctg |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48414911 |
atatgatggaagagacagaagggggcgaatgatccagcatgccagttacatagatgaaccgagtcttaggattcatggtaaagagttatccagcaagctg |
48414812 |
T |
 |
| Q |
161 |
aatcgtcgtgaatcagatccgtatccttaattgcaaaatactaggctaatatgcttgcaagttttattcacaggttc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48414811 |
aatcgtcgtgaatcagatccgtatccttaattgcaaaatactaggctaatatgcttgcaagttttattcacaagttc |
48414735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 62 - 202
Target Start/End: Complemental strand, 44774591 - 44774451
Alignment:
| Q |
62 |
tatgatggaagagacagaagggggcgaatgatccagcatgccagttacatagatgaatcgagtcttaggattcatggtaaagagttatccagcaagctga |
161 |
Q |
| |
|
||||||||||||||||||| ||||| |||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
44774591 |
tatgatggaagagacagaaaggggccaatgattcagcatgccagttacatagatgaaccgagtcttaggattcatggtaaagaggtagccagcaagctga |
44774492 |
T |
 |
| Q |
162 |
atcgtcgtgaatcagatccgtatccttaattgcaaaatact |
202 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
44774491 |
atcgtcgtgaatcagatccgtatcctcaattgtgaaatact |
44774451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University