View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0753_low_23 (Length: 292)
Name: NF0753_low_23
Description: NF0753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0753_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 11 - 263
Target Start/End: Original strand, 7090011 - 7090263
Alignment:
| Q |
11 |
cataggccattgagaaagcaaattatgggtgaatatggtaaatgtttaatgtagtccgtgatcatatagatatatgatacacctatggttcatcacacat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7090011 |
cataggccattgagaaagcaaattatggttgaatatggtaaatgtttaatgtagtccgtgatcatatagatatatgatacacctatggttcatcacacat |
7090110 |
T |
|
| Q |
111 |
gggtttcaacaagtgacaaatttgccaccccattatgacttataacacttttgtccaaaacaaaaggctttgtcgtgtcttggaacctcttgctatgtcc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7090111 |
gggtttcaacaagtgacaaatttgccaccccattatgacttacaacacttttgtccaaaacaaaaggctttgtcgtgtcttggaacctcttgctatgtcc |
7090210 |
T |
|
| Q |
211 |
ttgtgattttaatatatgttggtatgcactttttaacaattttgtgtacattg |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7090211 |
ttgtgattttaatatatgttggtatgcactttttaacaattttgtgtacattg |
7090263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3214 times since January 2019
Visitors: 4808