View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0753_low_24 (Length: 291)

Name: NF0753_low_24
Description: NF0753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0753_low_24
NF0753_low_24
[»] chr4 (2 HSPs)
chr4 (1-211)||(10417378-10417585)
chr4 (233-262)||(10417327-10417356)


Alignment Details
Target: chr4 (Bit Score: 98; Significance: 3e-48; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 10417585 - 10417378
Alignment:
1 atttagataaccggatatttacatacaaatattaaccggnnnnnnn-ctaaacggtcggtcatccacttttataaaatcggnnnnnnngttgaatgtcca 99  Q
    |||||||||||||||||||||||||||||||||||||||        ||||| ||||||||||||||||||||||||||||       ||||||||||||    
10417585 atttagataaccggatatttacatacaaatattaaccggttttttttctaaatggtcggtcatccacttttataaaatcggtttttttgttgaatgtcca 10417486  T
100 tattcataaccatatccat-ttttttcctaaaccatannnnnnnnnnnaacgaaaatatctatctccgttgattactctctttctctgagttcatccata 198  Q
    ||||||||||||||||||| |||||||||||||||||           ||||||||||||| ||||||||||||||||||  ||||||||||||||||||    
10417485 tattcataaccatatccatcttttttcctaaaccata---ttttttttaacgaaaatatctctctccgttgattactctc--tctctgagttcatccata 10417391  T
199 cacataggcatca 211  Q
    |||||||||||||    
10417390 cacataggcatca 10417378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 233 - 262
Target Start/End: Complemental strand, 10417356 - 10417327
Alignment:
233 gtgaaggaacacaaaatcagcatataaaat 262  Q
    ||||||||||||||||||||||||||||||    
10417356 gtgaaggaacacaaaatcagcatataaaat 10417327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University