View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0753_low_24 (Length: 291)
Name: NF0753_low_24
Description: NF0753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0753_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 98; Significance: 3e-48; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 10417585 - 10417378
Alignment:
| Q |
1 |
atttagataaccggatatttacatacaaatattaaccggnnnnnnn-ctaaacggtcggtcatccacttttataaaatcggnnnnnnngttgaatgtcca |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10417585 |
atttagataaccggatatttacatacaaatattaaccggttttttttctaaatggtcggtcatccacttttataaaatcggtttttttgttgaatgtcca |
10417486 |
T |
 |
| Q |
100 |
tattcataaccatatccat-ttttttcctaaaccatannnnnnnnnnnaacgaaaatatctatctccgttgattactctctttctctgagttcatccata |
198 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| ||||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10417485 |
tattcataaccatatccatcttttttcctaaaccata---ttttttttaacgaaaatatctctctccgttgattactctc--tctctgagttcatccata |
10417391 |
T |
 |
| Q |
199 |
cacataggcatca |
211 |
Q |
| |
|
||||||||||||| |
|
|
| T |
10417390 |
cacataggcatca |
10417378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 233 - 262
Target Start/End: Complemental strand, 10417356 - 10417327
Alignment:
| Q |
233 |
gtgaaggaacacaaaatcagcatataaaat |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10417356 |
gtgaaggaacacaaaatcagcatataaaat |
10417327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University