View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0753_low_25 (Length: 287)
Name: NF0753_low_25
Description: NF0753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0753_low_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 42 - 198
Target Start/End: Complemental strand, 17463625 - 17463470
Alignment:
| Q |
42 |
atgaacatgttaaggaactagatgctaagcttctcttgttgaaatttcaggccattatgatgatcattctacttttgttgagtttcattgcaatgttatt |
141 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17463625 |
atgaacatgttaaggaactaaatgctaagcttctcttgttgaaatttcaggccattatgatgatcattctacttttgttgagtttcattgcaatgttatt |
17463526 |
T |
 |
| Q |
142 |
ttacatattttggtaaagtttcacctcacacagttgttcatcaacttaaaatataaa |
198 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
17463525 |
ttacatattttggtaaagttt-acctcacacagttgttcatcaacttaaaatataaa |
17463470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 190 - 220
Target Start/End: Complemental strand, 17463091 - 17463061
Alignment:
| Q |
190 |
aaatataaatatgggatgaattgtgagactt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
17463091 |
aaatataaatatgggatgaattgtgagactt |
17463061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University