View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0753_low_28 (Length: 285)
Name: NF0753_low_28
Description: NF0753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0753_low_28 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 129; Significance: 8e-67; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 33 - 236
Target Start/End: Complemental strand, 26934668 - 26934471
Alignment:
| Q |
33 |
cttggggttcaggagctgtcgtggagaatcaaattcttcaagacatagcagctgcaaaagggaagactacagctcaggtaatttaacattataaaacatg |
132 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
26934668 |
cttggggttctggagctgtcgtggagaatcaaattcttcaagacatagcagcaggaaaagggaagactacagctcaggtaatttaacattataaattgtg |
26934569 |
T |
|
| Q |
133 |
tttatatatggtcatgtatatgataaaagtggttgttattttgttaaacccttacgaattacgacatttctgctatagcgaacatatagtgttgctatat |
232 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||| ||| ||||||| ||||||||||| |||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
26934568 |
tttataaatggtcatgtagatgataaaagtggtcgttgttttgttcaacccttacgagttacgatatttctgct------aacatatagtgttgctatat |
26934475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4313 times since January 2019
Visitors: 4832