View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0753_low_30 (Length: 280)
Name: NF0753_low_30
Description: NF0753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0753_low_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 37 - 239
Target Start/End: Complemental strand, 903301 - 903091
Alignment:
Q |
37 |
tgagatgaattgagtaattgagtgatttagtaccttggacaaagaatatctcttattcctctggccttttttcactcttaacggacacagtagggtaggg |
136 |
Q |
|
|
||||| |||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
903301 |
tgagaagaattgggtaattgagtgctttagtaccttggacaaagaatatctcttattcctctggccttttttcactcttaacggacacactagggtaggg |
903202 |
T |
 |
Q |
137 |
ttgtcccatttgtat--------gacaagagaaagacactacatatagagcaatattaaggtttcactattgcctatgtttaggtttatacctaagcccc |
228 |
Q |
|
|
|||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
903201 |
ttgttccatttgtatgacataatgacaagagaaagacactacatatagagcaatattaaggtttcactattgcctatgtttaggtttatacctaagcccc |
903102 |
T |
 |
Q |
229 |
cttgatgatgt |
239 |
Q |
|
|
||||||||||| |
|
|
T |
903101 |
cttgatgatgt |
903091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University