View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0753_low_31 (Length: 277)
Name: NF0753_low_31
Description: NF0753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0753_low_31 |
 |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0016 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 41 - 277
Target Start/End: Original strand, 6236 - 6472
Alignment:
| Q |
41 |
tgttgcacaaatgcatcaagcttttcaatcagatctgcagcagaattgcggttgttgcaagccatgcagaaagttggattatcatagctagatggatatg |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6236 |
tgttgcacaaatgcatcaagcttttcaatcggatctgcagcagaattgcggttgttgcaagccatgcataaagttggattatcatagctagatggatatg |
6335 |
T |
 |
| Q |
141 |
ggttgggagatggcggtgaagggaaggcagaagagatagtcggataacatggaacaatgtaggatgaatggaatggatttgtcttgggaggtgttcaagg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6336 |
ggttgggagatggcggtgaagggaaggcagaagagatagtcggataacatggaacaatgtaggatgaatggaatggatttgtcttcggaggtgttcaagg |
6435 |
T |
 |
| Q |
241 |
acgagagcaccaaatgataagtaaaagattgattatt |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6436 |
acgagagcaccaaatgataagtaaaagattgattatt |
6472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 41 - 277
Target Start/End: Complemental strand, 23386232 - 23385996
Alignment:
| Q |
41 |
tgttgcacaaatgcatcaagcttttcaatcagatctgcagcagaattgcggttgttgcaagccatgcagaaagttggattatcatagctagatggatatg |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
23386232 |
tgttgcacaaatgcatcaagcttttcaatcggatctgcagcagaattgcggttgttgcaagccatgcataaagttggattatcatagctagatggatatg |
23386133 |
T |
 |
| Q |
141 |
ggttgggagatggcggtgaagggaaggcagaagagatagtcggataacatggaacaatgtaggatgaatggaatggatttgtcttgggaggtgttcaagg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
23386132 |
ggttgggagatggcggtgaagggaaggcagaagagatagtcggataacatggaacaatgtaggatgaatggaatggatttgtcttcggaggtgttcaagg |
23386033 |
T |
 |
| Q |
241 |
acgagagcaccaaatgataagtaaaagattgattatt |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23386032 |
acgagagcaccaaatgataagtaaaagattgattatt |
23385996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University