View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0753_low_33 (Length: 271)
Name: NF0753_low_33
Description: NF0753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0753_low_33 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 1 - 130
Target Start/End: Original strand, 41531258 - 41531387
Alignment:
| Q |
1 |
catgcctactattgtgttaccattggaatcttctatctataaattgaaagcaaaacattttattcatcacacacacaccaaaatcttaaatcgtctataa |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| ||||| ||||| |||||||| |
|
|
| T |
41531258 |
catgcccactattgtgttaccattggaatcttctatctataaattgaaagcaaaacattttattcatcacataaacaccgaaatcataaattgtctataa |
41531357 |
T |
|
| Q |
101 |
ctaatatctttagtgtttttcatctcactc |
130 |
Q |
| |
|
||||||||||||||||||||| |||||||| |
|
|
| T |
41531358 |
ctaatatctttagtgtttttcctctcactc |
41531387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3070 times since January 2019
Visitors: 4805