View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0753_low_35 (Length: 264)
Name: NF0753_low_35
Description: NF0753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0753_low_35 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 134 - 190
Target Start/End: Complemental strand, 27225929 - 27225873
Alignment:
| Q |
134 |
acagccatgtaatttgggatcaatacaattagaaaggggtgaatcatctgtgctgct |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| |||| |||| |
|
|
| T |
27225929 |
acagccatgtaatttgggatcaatacaattagaaagggttgaatcatttgtggtgct |
27225873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 134 - 190
Target Start/End: Complemental strand, 10674105 - 10674049
Alignment:
| Q |
134 |
acagccatgtaatttgggatcaatacaattagaaaggggtgaatcatctgtgctgct |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| || |||| |||| |
|
|
| T |
10674105 |
acagccatgtaatttgggatcaatacaattagaaatgggtgaattatttgtggtgct |
10674049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4958 times since January 2019
Visitors: 4844