View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0753_low_37 (Length: 261)

Name: NF0753_low_37
Description: NF0753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0753_low_37
NF0753_low_37
[»] chr4 (2 HSPs)
chr4 (153-200)||(10417825-10417872)
chr4 (218-261)||(10417760-10417803)


Alignment Details
Target: chr4 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 153 - 200
Target Start/End: Complemental strand, 10417872 - 10417825
Alignment:
153 aatgatgttgaaaattaaaatgagttttctctgttgtttccatttaac 200  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||    
10417872 aatgatgttgaaaattaaaatgagttttctcggttgtttccatttaac 10417825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 218 - 261
Target Start/End: Complemental strand, 10417803 - 10417760
Alignment:
218 tagtgaatgttattttccaattaaaatgtccttggtttgaaaat 261  Q
    ||||||||||||| ||||||||||||||||||||||||||||||    
10417803 tagtgaatgttatcttccaattaaaatgtccttggtttgaaaat 10417760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University