View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0753_low_37 (Length: 261)
Name: NF0753_low_37
Description: NF0753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0753_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 153 - 200
Target Start/End: Complemental strand, 10417872 - 10417825
Alignment:
| Q |
153 |
aatgatgttgaaaattaaaatgagttttctctgttgtttccatttaac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10417872 |
aatgatgttgaaaattaaaatgagttttctcggttgtttccatttaac |
10417825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 218 - 261
Target Start/End: Complemental strand, 10417803 - 10417760
Alignment:
| Q |
218 |
tagtgaatgttattttccaattaaaatgtccttggtttgaaaat |
261 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10417803 |
tagtgaatgttatcttccaattaaaatgtccttggtttgaaaat |
10417760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University