View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0753_low_38 (Length: 260)
Name: NF0753_low_38
Description: NF0753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0753_low_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 20 - 222
Target Start/End: Original strand, 33185556 - 33185758
Alignment:
Q |
20 |
cacagaaaggatgagaagagttataaacttcttcttcaagagcatagaaaggaaccattagattcttcttttcatgaatcagaaaagtacaccaaagagg |
119 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
33185556 |
cacagaaaggatgagaagagttataaacttcttcttcaagagcatagaaaggaaccattagattcttcttttcatgaatcagaaaagtgcaccaaagagg |
33185655 |
T |
 |
Q |
120 |
atttcccataaccgtataatcttcaagctcaccagcttcttgaagaaagagtcgaacgttttcacggaacggacctgaaggtgaaattggacaaccaggg |
219 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33185656 |
atttcccataaccgtataatcttcaagctcaccagcttcttgaagaaagagtcgaacgttttcacggaacggacctgaaggtgaaattggacaaccaggg |
33185755 |
T |
 |
Q |
220 |
tca |
222 |
Q |
|
|
||| |
|
|
T |
33185756 |
tca |
33185758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University