View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0753_low_44 (Length: 234)
Name: NF0753_low_44
Description: NF0753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0753_low_44 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 37 - 182
Target Start/End: Original strand, 46399476 - 46399621
Alignment:
Q |
37 |
aaggggaagatgtaattaccaagccactacaacaataagagaaaccctaaagaggagaggagtataagtataacccaagaattagaacacagattatgtt |
136 |
Q |
|
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46399476 |
aaggggaagatgtaattaacaagccactacaacaataagagaaaccctaaagaggagaggagtataagtataacccaagaattagaacacagattatgtt |
46399575 |
T |
 |
Q |
137 |
gaatagtttttgaattataacagcattggattgcaatagctggtgc |
182 |
Q |
|
|
|||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
46399576 |
gaatagattttgaattttaacagcattggattgcaatagctggtgc |
46399621 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University