View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0753_low_47 (Length: 224)

Name: NF0753_low_47
Description: NF0753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0753_low_47
NF0753_low_47
[»] chr5 (1 HSPs)
chr5 (74-224)||(38005872-38006022)
[»] chr3 (1 HSPs)
chr3 (84-224)||(26461791-26461931)


Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 74 - 224
Target Start/End: Original strand, 38005872 - 38006022
Alignment:
74 gagatgaactccggcgattataggtaggaaacggaggacggtgagctggagatcaccgacattggattggaaagtgtcatagagccaacgacaaagattg 173  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38005872 gagataaactccggcgattataggtaggaaacggaggacggtgagctggagatcaccgacattggattggaaagtgtcatagagccaacgacaaagattg 38005971  T
174 ttgtcgccagcaccggagctgggttggcggaggagggtggcgatttggttg 224  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
38005972 ttgtcgccagcaccggagctgggttggcggaggagggtggcgatttggttg 38006022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 84 - 224
Target Start/End: Complemental strand, 26461931 - 26461791
Alignment:
84 ccggcgattataggtaggaaacggaggacggtgagctggagatcaccgacattggattggaaagtgtcatagagccaacgacaaagattgttgtcgccag 183  Q
    |||||||| || || |||||||| ||||||||||| |||||||||  || ||| |||||||||||||| |||||||||||||||||||||||||| || |    
26461931 ccggcgataatcgggaggaaacgtaggacggtgagttggagatcagtgatatttgattggaaagtgtcgtagagccaacgacaaagattgttgtcaccgg 26461832  T
184 caccggagctgggttggcggaggagggtggcgatttggttg 224  Q
    | |||||| ||||||||||||||||||||||||||||||||    
26461831 cgccggagttgggttggcggaggagggtggcgatttggttg 26461791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University