View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0753_low_47 (Length: 224)
Name: NF0753_low_47
Description: NF0753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0753_low_47 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 74 - 224
Target Start/End: Original strand, 38005872 - 38006022
Alignment:
Q |
74 |
gagatgaactccggcgattataggtaggaaacggaggacggtgagctggagatcaccgacattggattggaaagtgtcatagagccaacgacaaagattg |
173 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38005872 |
gagataaactccggcgattataggtaggaaacggaggacggtgagctggagatcaccgacattggattggaaagtgtcatagagccaacgacaaagattg |
38005971 |
T |
 |
Q |
174 |
ttgtcgccagcaccggagctgggttggcggaggagggtggcgatttggttg |
224 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38005972 |
ttgtcgccagcaccggagctgggttggcggaggagggtggcgatttggttg |
38006022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 84 - 224
Target Start/End: Complemental strand, 26461931 - 26461791
Alignment:
Q |
84 |
ccggcgattataggtaggaaacggaggacggtgagctggagatcaccgacattggattggaaagtgtcatagagccaacgacaaagattgttgtcgccag |
183 |
Q |
|
|
|||||||| || || |||||||| ||||||||||| ||||||||| || ||| |||||||||||||| |||||||||||||||||||||||||| || | |
|
|
T |
26461931 |
ccggcgataatcgggaggaaacgtaggacggtgagttggagatcagtgatatttgattggaaagtgtcgtagagccaacgacaaagattgttgtcaccgg |
26461832 |
T |
 |
Q |
184 |
caccggagctgggttggcggaggagggtggcgatttggttg |
224 |
Q |
|
|
| |||||| |||||||||||||||||||||||||||||||| |
|
|
T |
26461831 |
cgccggagttgggttggcggaggagggtggcgatttggttg |
26461791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University