View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0753_low_51 (Length: 204)
Name: NF0753_low_51
Description: NF0753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0753_low_51 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 8e-60; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 52245636 - 52245752
Alignment:
| Q |
1 |
aaatgatgctttctaactgtctttttcgagcaggtggttgttccatgcttttcacaaacaaaacagaactgaaagatagagccatcttgaaactgaaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52245636 |
aaatgatgctttctaactgtctttttcgagcaggtggttgttccatgcttttcacaaacaaaacagaactgaaagatagagccatcttgaaactgaaaca |
52245735 |
T |
|
| Q |
101 |
catggaaagaacacagt |
117 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
52245736 |
catggaaagaacacagt |
52245752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4335 times since January 2019
Visitors: 4832