View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0754_high_12 (Length: 317)
Name: NF0754_high_12
Description: NF0754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0754_high_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 89 - 282
Target Start/End: Complemental strand, 44865514 - 44865321
Alignment:
| Q |
89 |
atcatcagcaatttgggaatgatggaaatattcattagtatcatgagctgccttctgtttcctcgcacaccgtgaaattgaattatcatcagccttcttt |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44865514 |
atcatcagcaatttgggaatgatggaaatattcattagtatcgtgagctgccttctgtttcctcgcacaccgtgaaattgaattatcatcagccttcttt |
44865415 |
T |
|
| Q |
189 |
tctggcatacattcgccctttagattccaggagttcttctcagacattaaatctgacaaaagtttcttctttttgccggtttgcttcatattct |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44865414 |
tctggcatacattcgccctttagattccaggagttcttctcagacattaaatctgacaaaagtttcttctttttgccggtttgcttcatattct |
44865321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 74; Significance: 6e-34; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 89 - 281
Target Start/End: Original strand, 28753326 - 28753521
Alignment:
| Q |
89 |
atcatcagcaatttgggaatgatggaaatattcatt---agtatcatgagctgccttctgtttcctcgcacaccgtgaaattgaattatcatcagccttc |
185 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||| |||||||| ||||||||| ||||||| ||| |||||||||||| || || |||| ||| |
|
|
| T |
28753326 |
atcatcagcaatttgggaatgatgaaaataatcatatgaagtatcatacgctgccttccgtttcctgccacgtcgtgaaattgaactaccaccagctttc |
28753425 |
T |
|
| Q |
186 |
ttttctggcatacattcgccctttagattccaggagttcttctcagacattaaatctgacaaaagtttcttctttttgccggtttgcttcatattc |
281 |
Q |
| |
|
|||| ||| |||||||| || ||| || ||||| ||||| ||||||||||||||||||||||||||| ||||||||||| || |||||| ||||| |
|
|
| T |
28753426 |
ttttttggtatacattcaccatttggagtccagacgttctcctcagacattaaatctgacaaaagttttttctttttgccagtctgcttcgtattc |
28753521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4103 times since January 2019
Visitors: 4827