View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0754_high_16 (Length: 251)
Name: NF0754_high_16
Description: NF0754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0754_high_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 55074266 - 55074501
Alignment:
| Q |
1 |
tgaatttctcaacctgcatgtagtgttggctagtgtcttaaaattacagggcttccccatgtggtcctgcctaattaatacaaaaattgtaatcggacaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55074266 |
tgaatttctcaacctgcatgtagtgttggctagtgtcttaaaattgcagggcttccccatgtggtcctgcctaattaatacaaaaattgtaatcggacaa |
55074365 |
T |
|
| Q |
101 |
acatctacatctcatgtgtataccactatattggtcttaccttgtcttcgtcttgcttctttttaccatgtttccaagccacataaaattatctttcaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55074366 |
acatctacatctcatgtgtataccactatattggtcttaccttgccttcgtcttgcttctttttaccatgtttccaagccacataaaattatctttcaaa |
55074465 |
T |
|
| Q |
201 |
attaattaaatatccgtatacggccatgtcctgaat |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
55074466 |
attaattaaatatccgtatacggccatgtcctgaat |
55074501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4364 times since January 2019
Visitors: 4835