View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0754_high_21 (Length: 213)
Name: NF0754_high_21
Description: NF0754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0754_high_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 79; Significance: 4e-37; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 5823714 - 5823628
Alignment:
Q |
1 |
actgctatggtgtcggcatttctaatagttgttaaacggtgtgcaacaactacggtagtcctttgtgtcataactttttcctatgct |
87 |
Q |
|
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
5823714 |
actgctatggtgtcagcatttctaatagttgttaaacggtgtgcaacaactacggtagtcctttgtgtcataactttttccaatgct |
5823628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 16 - 87
Target Start/End: Complemental strand, 5766306 - 5766235
Alignment:
Q |
16 |
gcatttctaatagttgttaaacggtgtgcaacaactacggtagtcctttgtgtcataactttttcctatgct |
87 |
Q |
|
|
|||||||| |||||||||||||| |||||||||||||||||||| ||||||||||||||||||||| ||||| |
|
|
T |
5766306 |
gcatttcttatagttgttaaacgatgtgcaacaactacggtagttctttgtgtcataactttttccaatgct |
5766235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University