View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0754_low_10 (Length: 423)
Name: NF0754_low_10
Description: NF0754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0754_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 7e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 7e-99
Query Start/End: Original strand, 102 - 300
Target Start/End: Complemental strand, 35207205 - 35207007
Alignment:
| Q |
102 |
aataccttccctactcaaaaaccatacgccagagaaacaaaacgccaaatccaaattcttctcatattcttccaataccttcaatcacataactctttca |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35207205 |
aataccttccctactcaaaaaccatacgccagagaaacaaaacgccaaatccaaattcttctcatattcttccaagaccttcaatcacataactctttca |
35207106 |
T |
|
| Q |
202 |
tccccaagccaatcattcccgtcttctccgaacttcacttcacactacaaaaaattcacttcttattccaagattgttcaattcaaggcacaggtctct |
300 |
Q |
| |
|
||||| | ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35207105 |
tcccccaaccaatcattcctgtcttctccgaacttcacttcacactacaaaaaattcacttcttattccaagattgttcaattcaaggcacaggtctct |
35207007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3230 times since January 2019
Visitors: 4808